2.1.

Fly Stocks and Generation of Transgenic Flies

Two twi-24B-gal4 lines, a mesoderm and a heart driver,²⁰ were obtained from the Bloomington Stock Center. All fly stocks and genetic crosses were maintained on standard yeast-glucose medium at 25°C. To generate the ACER RNA interference construct, UAS-ACER-RNAi and ACER-cDNA (LD28328) were obtained from J. L Juang of the National Health Research Institutes of Taiwan. A 523-bp DNA fragment was PCR amplified using a pair of primers, 5′-CGCGTCTAGAGTGCTGGAGGCGCGTAGGTTC-3′ and 5′-CGCGTCTAGAGTCGGCATAGGAGCGGTGACC-3′ (with the XbaI site underlined). The amplified DNA fragment was digested with XbaI, and then cloned first onto the AvrII site. Subsequently, the same DNA fragment was subcloned onto the NheI site of a pWIZ vector as described in Ref. 21. The orientation of the DNA construct was confirmed by restriction enzyme digestion. To generate transgenic flies, the standard germ-line transformation procedure using $w^{1118}$ as the parental line was performed.

2.2.

RT-PCR

RT-PCR was used to determine the silencing efficiency of the transgenic flies carrying the UAS-ACER RNAi construct. Three flies carrying transgene and $w^{1118}$ were driven by twi-24B-gal4. PCR was performed using the ACER-specific primers, ACER 2-1-3′ CACAAACGGCTTCTCCGGAT and ACER 2-5′ AACTGGCTTGGTATTG, as well as rps17 primers, 5′-CGAACCAAGACGGTGAAGAAG-3′ and 5′-CCATAGAGGTAGTTCAACGTCC-3′, to assess the expression of the transgene. Phenotypic analysis of all the transgenic lines exhibited similar cardiac phenotypes. Several transgenic lines were obtained for ACER-Ri9, which exhibited the strongest silencing efficiency and was thus used for phenotypic analysis (Fig. 1).

Fig. 1

(a) The expression levels of angiotensin-converting enzyme-related (ACER) mRNA in knock-down flies. (b) RT-PCR showed that the expression levels of twi-24B>ACER-Ri9 were 45% of the wild-type control. Rps17 was used as a loading control. The relative expression levels were compared using Student’s t-test; ***$P<0.001$.

2.3.

SS-OCT Measurements and Quantification of Heartbeat Parameters

To acquire the contractile parameters of adult flies, similar protocols were adopted.^13,19 Briefly, in each experiment, two-dimensional (2-D) OCT images were first obtained in the longitudinal direction to identify the dorsal midline of the A1–A3 abdominal segments of the Drosophila. Then, the OCT image orientation was rotated by 90 deg, such that the conical chamber (CC) of the heart was acquired in the transverse plane. Measurements were always made in the same location in the abdominal segment. A group of 20 flies was examined with an SS-OCT system (OCM1300SS, Thorlabs Inc., Newton, New Jersey). The median wavelength of the SS-OCT system was 1310 nm with an axial resolution of $\sim 12\mu \mathrm{m}$ in tissue, a total power of 10 mW, and an A-scan rate of 16 kHz. Since heart function of Drosophila decelerates greatly between 5 and 7 weeks of age, to assess the age-dependent heartbeat parameters, 1-, 3-, and 7-week old flies were used. It has been previously reported that anesthetic treatment induces cardiac arrhythmias in mice, and that carbon dioxide or ether affects heart performances in Drosophila.^22–24 To sidestep the aforementioned issues, during the image assessment, the Drosophila were first anesthetized with triethyl amine, and then gently immobilized on wax gel with the dorsal side facing the OCT probe. The flies were subsequently allowed to return to a fully awake state on the bench for 20 min before being subjected to OCT scanning.

Figure 2 is a representative video depicting a transverse 2-D OCT image of the CC in the heart during diastole and systole in 1-week old wild-type Drosophila. By acquiring in-depth scans at the midline of the CC overtime without scanning, one can obtain an M-mode image of the vertical movements of the edges of the heart ($y$-axis) overtime ($x$-axis). M-mode OCT images can provide the contraction pattern which gives us an objective assessment of heart wall motion.

Fig. 2

A representative B-mode optical coherence tomography (OCT) in male twi-24B-gal4/+ in 1 week of age (Video 1, MPEG, 1.97 MB) [URL: http://dx.doi.org/10.1117/1.JBO.19.1.011014.1].

We then employed a method we had previously proposed¹⁹ for the rapid analysis of the beat-to-beat contraction–relaxation parameters of the heart in Drosophila by using semiautomatic cardiac chamber segmentation in B-mode OCT images based on the random walker algorithm. Random walker²⁵ is a semiautomatic segmentation method based on graph theory that can provide a unique solution that is robust to weak/noisy object boundaries such as the cardiac tube of Drosophila. Further details and proofs can be found in Refs. 19 and 26. Briefly, after contrast enhancement of the image, we created an initial set of seed points on the first frame. In the next frame, the cross-sections of the heart tube were automatically segmented in a total of 2000 frames, and the size of the inner margin was represented by the area for each Drosophila. Then, depending on the histogram distribution of the changing area during each heartbeat cycle, various contractile parameters, including the HR, EDD, ESD, and %FS, were determined accordingly (see Ref. 19 for details). The FS was calculated as $[(\mathrm{EDD}-\mathrm{ESD})/\mathrm{EDD}]\times 100$, which represents the extent of the changes in the cardiac diameter during systole; this can provide an estimate of the contractility of the heart tube.

2.4.

Electrical Pacing

To monitor the stress-induced cardiac performance of adult flies, external heart pacing stress protocol was adopted and modified.¹⁴ For each genotype, 100 flies were anesthetized with FlyNap® (Carolina Biological Supply Company, Burlington, North Carolina) for 3 min and 30 s and paced with a standard square wave stimulator at 40 V and 6 Hz for 30 s. In heart failure, we meant that either cardiac arrest or fibrillation was observed via the phase difference microscope within 2 min. The failure rate is defined as the number of flies with heart failure divided by the total number of flies.

2.5.

Survivorship Assay

A group of 10 newly enclosed flies were collected and cultured with standard media in a vial at 25°C. Viable flies were scored and transferred to a new vial every 5 days. The log-rank test was performed to determine the differences in the lifespan of the flies.

2.6.

Statistical Analyses

Statistical analyses were performed using SPSS (version 14.0, SPSS Inc., Chicago). $P\text{values}<0.05$ were considered to be statistically significant. The relative differences between the two groups were compared using the Student’s t-test; ***$P<0.001$; **$P<0.01$; *$P<0.05$.

3.1.

Down-Regulation of ACER Impaired Contractile Properties of Drosophila Heart

Previous studies indicated that ACER is critical for the heart morphogenesis of Drosophila.⁸ Nevertheless, the function of ACER in heart physiology has not been precisely determined. To address this question, we have utilized RNA interference to knock-down the ACER expression. The expression of the silencing construct was driven by the mesodermal- and cardial-specific gal4 driver, twi-24B-gal4, using a UAS/gal4 system.²⁷ Quantitative RT-PCR showed that the knock-down efficiency of double-stranded ACER RNAi construct in late-fly embryos was moderate. In comparison with the case of the control twi-24B-gal4 flies, the relative expression levels of ACER mRNA was 45% in ACER knock-down flies, twi-24B-gal4>ACER-Ri9 (Fig. 1).

Having successfully knock-downed the expression of ACER, we next employed SS-OCT imaging to acquire various heartbeat parameters. As can be seen from Fig. 2, a transverse image of the conical CC of an adult Drosophila underneath the dorsal midline of the A1–A3 abdominal segments was obtained using SS-OCT. The cardiac chamber contracted rhythmically with occasional irregular pulsing activities (see Video 1). Since the flies did not possess red blood cells in their circulatory fluids, the heart chambers showed up as darker pixels under OCT. During heart contractions, the darker pixels, corresponding to the edges of the heart tube, crossed over to become lighter background pixels.

We found that ACER knock-down flies exhibited significantly enlarged systolic chamber dimensions with markedly impaired systolic functions as demonstrated in the B-mode images (see Fig. 3, Video 2). The representative M-mode OCT images of both wild-type control and ACER knock-down flies in 1, 3, and 7-week old flies are also shown in Fig. 4. The results for ACER knock-down Drosophila at different ages conclusively indicated impaired systolic functions with enlarged diastolic and systolic diameters as compared with wild-type flies.

Fig. 3

A representative B-mode OCT image in ACER knock-down flies in 3 week of age (Video 2, MPEG, 1.94 MB) [URL: http://dx.doi.org/10.1117/1.JBO.19.1.011014.2].

Fig. 4

Representative M-mode OCT images in wild-type control (twi-24B-gal4/+) and ACER silencing lines (twi-24B>ACER-Ri9) in (a) 1, (b) 3, and (c) 7 weeks of age.

To better assess the age-dependent contractile properties of Drosophila, parameters including the HR, EDD, ESD, and FS were computed from wild-type and ACER-Ri9 flies during aging. Both wild-type and ACER-Ri9 flies exhibited an age-dependent decline in the HR [Fig. 5(a)]. Nevertheless, the decline in HR of ACER-Ri9 flies was consistently slower than that of wild-type flies. The differences in the HR between wild-type and ACER-Ri9 flies were more evident than in aged animals [Fig. 5(a)]. The average HR of wild-type and ACER-Ri9 flies were 261.86 and 242.02 bpm, respectively. In young wild-type flies, the ESD was not significantly altered. However, in 7-week old wild-type flies, ESD decreased [Fig. 5(b)]. Unlike the case of wild-type flies, the ESD of ACER knock-down flies increased with age [Fig. 5(b)]. The EDD of the wild-type flies was indistinguishable from that of the ACER-Ri9 flies [Fig. 5(c)]. However, the EDD of both wild-type and ACER-Ri9 flies decreased at the age of 7 weeks, and the EDD of the ACER-Ri9 flies was significantly larger than that of the wild-type flies [Fig. 5(c)]. Moreover, we found that the FS of the wild-type flies did not decline with age [Fig. 5(d)]. In contrast, the FS of ACER-Ri9 flies declined consistently with age and was significantly decreased compared with the wild-type flies [Fig. 5(d)]. Since the FS represents the extent of the changes in the cardiac chamber during systole and can be used as an index of cardiac contractibility, our results suggested that the down-regulation of ACER impaired the contractile properties of the Drosophila heart.

Fig. 5

Cardiac parameters in male wild-type control (twi-24B-gal4/+) and ACER silencing lines (twi-24B>ACER-Ri9) at 1, 3, and 7 weeks of age showing (a) heart rate (HR), (b) end-systolic diameter (ESD), (c) end-diastolic diameter (EDD), and (d) percent fractional shortening (%FS). Data points represent the mean ($\pm \mathrm{SEM}$) for 20 flies per data point; ***$P<0.001$; **$P<0.01$; *$P<0.05$.

3.2.

Impact of Down-Regulation of ACER on Cardiac Performance of Adult Flies

As shown above, silencing the expression of ACER reduced the contractile properties of the Drosophila heart (Fig. 5), and it is very likely that the deficit in ACER may also affect the heart performance in flies. To study this issue, a stress protocol was employed to test the stress-induced heart functions of the ACER knock-down flies. We found that down-regulating the ACER expression increased the likelihood of heart failure during electrical cardiac pacing in ACER knock-down flies in the ages of 1 week (chi-squared test, $P<0.05$) and 7 weeks (chi-squared test, $P<0.01$) (Fig. 6). Since down-regulation of ACER affected both the contractibility and the performance of the adult heart in Drosophila, we conclude that ACER is essential for the cardiac functions in Drosophila (Figs. 5 and 6).

Fig. 6

Heart failure rate during pacing in both wild-type control (twi-24B-gal4/+) and ACER silencing lines (twi-24B>ACER-Ri9) at 1, 3, and 7 weeks of age; ***$P<0.001$; **$P<0.01$; *$P<0.05$.

3.3.

Necessity of ACER for the Longevity of Drosophila

It has been shown that modulation of the gene expression in the heart can alter the longevity of Drosophila.²⁸ As shown above, cardiac-specific down-regulation of ACER did indeed exacerbate the age-dependent cardiac functions of Drosophila. We posit that the down-regulation of ACER directly impacts the longevity of the flies. In a survivorship assay, we found that the mean lifespans of control twi-24B-gal4 and twi-24B-gal4>ACER flies were 66.85 and 54.90 days, respectively (Fig. 7). Statistical analyses revealed that the differences in the survivorships of the wild-type control and ACER knock-down flies were significant (log-rank test, $P<0.001$) indicating that the activity of ACER is essential for the survival of the flies.

Fig. 7

Down-regulation of ACER reduced the lifespan of Drosophila. Survivorship curve of both wild-type control (twi-24B-gal4/+) and ACER silencing lines (twi-24B>ACER-Ri9) log-rank analysis.