Translator Disclaimer
1 May 2008 Rab4 and Rab11 coordinately regulate the recycling of angiotensin II type I receptor as demonstrated by fluorescence resonance energy transfer microscopy
Author Affiliations +
Abstract
The recycling of G-protein-coupled receptors (GPCR) to the cell surface after internalization plays an important role in the regulation of overall GPCR activity. The angiotensin II type I receptor (AT1R) belongs to class B GPCRs that recycle slowly back to the cell surface. Previous studies have proposed that Rab11 controls the recycling of AT1R; however, recent reports show that Rab4, a rapid recycling regulator, co-localizes also with internalized AT1R. Different from the subcellular co-localization provided by fluorescence microscopy, fluorescence resonance energy transfer (FRET) microscopy provided the spatial relationship of AT1R with Rab4 and Rab11 in the nanometer-range proximity during the entire course of AT1R recycling. During the early recycling stage, internalized AT1Rs were mainly associated with Rab4 in the cytoplasm. During the mid-recycling stage, AT1Rs were associated with both Rab4 and Rab11 in the perinuclear compartments. However, during the late-recycling stage, AT1Rs were mainly associated with Rab11, both in the perinuclear compartments and the plasma membrane. Co-immunoprecipitation data confirmed these dynamic associations, which were disrupted by silencing of either the Rab4 or Rab11 gene. Based on these observations, we propose a Rab4 and Rab11 coordinated model for AT1R recycling.

1.

Introduction

The binding of angiotensin II (Ang II) to the Ang II type I receptor (AT1R) , a member of the superfamily of G-protein-coupled receptors (GPCRs), activates Gq11 and initiates a series of intracellular processing,1, 2, 3 including rapid phosphorylation, desensitization, and endocytosis of the AT1R . The internalized AT1R , via clathrin-coated vesicles (CCV), binds to β -arrestins and dynamin.4, 5 CCVs fuse with sorting endosomes shortly after internalization with participation of a number of Rab GTPases.

The Rab family proteins are a 23-25kDa ras superfamily of GTPases that contain two C-terminal geranylgeranyl (20 carbons) groups serving to bind proteins tightly to membranes.6 To date, over 60 mammalian Rab proteins have been identified; each Rab protein appears to associate with a particular membrane compartment(s) and regulate intracellular protein trafficking, such as endocytosis, endosome fusion, exocytosis, and recycling of GPCRs. 7, 8

It is believed that two distinct intracellular systems regulate the recycling of internalized GPCRs: one is the Rab4-mediated rapid recycling pathway, and the other is the Rab11-mediated slow endosome pathway. 5, 6, 7, 8, 9 Rab4 is mainly localized in early endosomes and is thought to play an important role in the efflux of cargo proteins out of early endosomes and the rapid recycling of cargo proteins directly to the plasma membrane from the early endosome.10, 11 Rab11 is mainly localized in perinuclear recycling endosomes and the trans-Golgi network and regulates the slow recycling from perinuclear endosomes and the trans-Golgi network to the plasma membrane.12, 13

Internalized GPCRs recycle back to the cell surface through different pathways.5, 8 Based on their affinity to and association with β -arrestins, GPCRs are divided into two classes4: class A receptors, which bind weakly with β -arrestins and recycle rapidly back to the plasma membrane, and class B receptors, which bind tightly with β -arrestins and recycle slowly back to the plasma membrane. The rapid recycling of β2 -adrenogenic receptor (β2AR) , a typical class A GPCR, appears to be regulated by Rab4, directly from early endosomes,14 and may15 or may not16 be regulated by Rab11. AT1R , a typical class B GPCR, is suggested to be regulated by Rab11 for its recycling.16, 17 Overexpression of wild-type Rab11 and constitutively active Rab11 (Q70L) significantly increases AT1AR recycling to the plasma membrane.16 Several studies have indicated that Rab11 also regulates the recycling of other class B GPCRs, such as vasopressin V2 receptor,18 CXC chemokine receptor 2,19 β -isoform of the thromboxane A2 receptor,20 and M4 muscarinic acetylcholine receptor.21 Recently, Rab4 has also been suggested to participate in AT1R recycling.22 Thus, the roles of Rab4, Rab11, or both in the recycling of the AT1R are not well understood.

In the current study, fluorescence resonance energy transfer (FRET) microcopy23 was employed to detect the dynamic relationship between AT1R and endogenous Rab4 or Rab11 during the 3h of the entire recycling course after the internalization of AT1R . FRET is a powerful tool to detect protein-protein interaction of less than 10-nm distance,24 and it can overcome the limitation (resolution is hundreds of nm) of the methods used in most of previous studies on the morphological co-localization of Rab4 and Rab11 with the cargo GPCR. Moreover, some of the Rab-dominant negative mutants used in several studies are not GTPase-defective, as originally presumed.25 Here, we provide additional insights into the relationship between Rab4/Rab11 and AT1R recycling. We observed that both Rab4 and Rab11 are associated with the AT1R recycling, and the association varies depending upon the recycling stage, as observed by FRET microscopy and co-immunoprecipitation. Moreover, gene knockdown of either Rab4 or Rab11 by specific siRNAs disrupts their dynamic association and AT1R recycling. Based on these studies, we propose a model of a Rab4 and Rab11 coordinated regulation of AT1R recycling.

2.

Materials and Methods

2.1.

Antibodies and Reagents

Monoclonal mouse Rab4 and Rab11 antibodies were purchased from BD Transduction Laboratories (Lexington, Kentucky). Polyclonal rabbit anti-GFP, polyclonal rabbit anti-Rab4, and polyclonal goat anti-Rab11 and normal mouse, rabbit, and goat antibodies were obtained from Santa Cruz Biotechnology (Santa Cruz, California). Alexa-546, Alexa-555, and Alexa-633 protein labeling kits were obtained from Molecular Probes (Eugene, Oregon). Cycloheximide and other obtained reagents were obtained from Sigma (St. Louis, MO).

2.2.

Cell Culture and Transfection

Human embryonic kidney (HEK) 293 cells from ATCC (Manassas, Virginia) were cultured in Dulbecco’s modified Eagle’s medium (DMEM) (Invitrogen) containing 4.5gL glucose, 10% fetal bovine serum (FBS), 2mM L -glutamine, and 1mM sodium pyruvate. Human AT1R -EGFP (enhanced green fluorescence protein) or its empty vector pEGFP-N126 was transfected into HEK 293 cells using Lipofectamine 2000 transfection reagents (Invitrogen), as described previously,27 according to the manufacturer’s instructions. Transfectants were selected with G418. Stable transfectants were tested and confirmed by immunoblotting with anti-GFP and anti- AT1R antibodies, flow cytometry, and radioligand binding assay (data not shown). The EGFP tag did not interrupt the function of AT1R , determined by a dose-dependent Ang II–induced phosphorylation of extracellular signal-regulated kinase (ERK1/2) (data not shown). The stably transfected cells expressing human AT1R -EGFP were designated in this study as AT1R HEK 293 cells.

2.3.

siRNA and Transfection

Specific Rab4 (AATGCAGGAACTGGCAAATCT), Rab11 (AAGAGTAATCTCCTGTCTCGA), and negative control (AATTCTCCGAACGTGTCACGT) siRNA duplexes were purchased from Qiagen (Valencia, California). AT1R HEK 293 cells were transfected with these siRNA using Lipofectamine 2000 transfection reagents (Invitrogen) according to the manufacturer’s instructions. After siRNA treatment for 36h , cells were split into three portions. A small portion of cells was used to check Rab4 and Rab11 levels by immunoblotting with anti-Rab4 and Rab11 antibodies [Fig. 1b ]. The largest portion of cells was used for immunoprecipitation experiments [Fig. 1c]. The third portion of the cells was dispersed in DMEM containing 10% FBS and placed ( 5×104 cells per well) on six-well plates with collagen I-coated coverslips; the attached cells were gently washed and fixed with 4% formaldehyde in PBS for observation of AT1R -EGFP fluorescence at the indicated recycling times after the cells have been treated with Ang II for 15min (Fig. 2 ).

Fig. 1

Co-immunoprecipitation of AT1R , Rab4, and Rab11. (a) AT1R HEK 293 cells treated without (lane 1) or with Ang II ( 100nM , 15min ) were co-immunoprecipitated following the procedure described in Sec. 2 for recovery of 0 (lane 2), 15 (lane 3), 45 (lane 4), 120 (lane 5), and 180 (lane 6) min, respectively. Cell homogenates were incubated with anti-GFP IgG (5μg) , and precipitated proteins were separated by SDS-PAGE and immunoblotted with Rab4 or Rab11 mAbs, as indicated. (b) 30μg protein homogenates from AT1HEK 293 cells untreated (lane 1) or treated with Rab4 (lane 2) or Rab11 (lane 3) siRNA and negative control siRNAs (lane 4) were immunoblotted with antibodies against Rab4, Rab11, or actin, as indicated. (c) As in (a), Rab4 siRNA-transfected cells were treated without (lane 1) or with Ang II ( 100nM , 15min ) following recovery of 0 (lane 2), 15 (lane 3), 45 (lane 4), 120 (lane 5), and 180 (lane 6) min, respectively. Cell homogenates were precipitated with anti-GFP IgG (5μg) and immunoblotted with Rab11 mAb. (d) As in (c), Rab11 siRNA-trasnfected cells were treated without (lane 1) or with Ang II ( 100nM , 15min ) following recovery of 0 (lane 2), 15 (lane 3), 45 (lane 4), 120 (lane 5), and 180 (lane 6) min, respectively. Cell homogenates were precipitated with anti-GFP IgG (5μg) and immunoblotted with Rab4 mAb.

031206_1_052803jbo1.jpg

Fig. 2

Interruption of AT1R recycling with either Rab4 or Rab11 gene silencing. AT1R HEK 293 cells were transfected without (solid line) or with either Rab4 siRNA (broken line) or Rab11 siRNA (dashed line) for 36h . Then, cells were treated as described in Sec. 2. The amount of cell surface AT1R was assessed by the average intensity of AT1R fluorescence at the plasma membrane using Metamorph 7.0. Data are mean ± SE, n=46 .

031206_1_052803jbo2.jpg

2.4.

Immunoprecipitation and Immunoblotting

Vehicle- or siRNA-transfected AT1R HEK 293 cells were homogenized by freeze-thaw (5×) in a lysis buffer ( 20mM TrisHCl , pH 8.01mM EDTA1mM NaN32mM DTT0.25M sucrose), with 0.5mM 4-(2-aminoethyl)benzenesulfonyl fluoride (AEBSF), 0.5mM benzamidine hydrochloride, and protease inhibitors (soybean and lima bean trypsin inhibitors, leupeptin, and aprotinin, each 1μgml ). The homogenates (1mg) were incubated (rocking, 4°C , 4h ) with 5μg of anti-GFP rabbit IgG, 4μg of anti-Rab4 rabbit IgG, or 6μg of anti-Rab11 goat IgG in 0.5ml of the lysis buffer with 20μM MgCl2 , 0.1% ovalbumin, 0.5mM AEBSF, 0.5% 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate. Controls were normal rabbit, mouse, or goat IgG (data not shown). After adding 60μl of a 50% slurry of protein G-Sepharose CL-4B (Amersham Pharmacia, Uppsala, Sweden) in PBS and incubation at 4°C overnight, the beads were washed three times with 1ml of ice-cold PBS, containing 0.5mM AEBSF. Proteins bound to beads were eluted in 80μl of loading buffer at 65°C for 10min , separated by SDS/PAGE (sodium dodecyl sulfate/polyacrylamide gel electrophoresis) in 4 to 12% gradient gels, and transferred onto nitrocellulose membrane for incubation with mAb against Rab4 or Rab11 and rabbit anti-GFP, followed by appropriate horseradish peroxidase-conjugated secondary antibodies and detection using Super Signal Chemiluminescent substrate (Pierce, Rockford, IL).

2.5.

Confocal Immunofluorescence Microscopy

AT1R HEK 293 cells were fixed with 4% paraformaldehyde in PBS for 20min at room temperature. After washing with PBS, the fixed cells on coverslips were incubated overnight at 4°C with Alexa Fluor 633-conjugated monoclonal mouse Rab4 antibody ( 2μgml ; Alexa Fluor 633 protein labeling kit, Molecular Probe, Eugene, Oregon) or Alexa Fluor 546-conjugated polyclonal goat Rab11 antibody ( 5μgml ; Alexa Fluor 546 protein labeling kit, Molecular Probe). The coverslips were mounted in SlowFade mounting medium (Molecular Probe) and sealed onto glass slides. Samples were imaged using an Olympus Fluoview FV300 laser scanning confocal microscope equipped with a 60×1.4 NA objective.

2.6.

Receptor Recycling Assays

Vehicle- or siRNA-transfected AT1R HEK 293 cells were treated with vehicle or 100nM Ang II for 15min at 37°C and then placed on ice. After washing three times with ice-cold, serum-free DMEM medium, the cells were recultured in complete culture medium containing 20μgml cycloheximide and reincubated at 37°C (with 5% CO2 ) for the indicated time from 0 to 180min . The cells were then fixed with 4% paraformaldehyde for fluorescence microscopy. The density of AT1R at the cell surface was determined by quantifying cell surface fluorescence using MetaMorph 7.0 (Molecular Devices, Downington, Pennsylvania).27 After identifying the plasma membrane, regions of interest (ROIs) were drawn manually in 300× zoomed-in images. The background was subtracted from each image, and then the images were thresholded to identify specific EGFP fluorescence for AT1R at the plasma membrane. Receptor recycling was defined as the recovery of cell-surface receptors following the removal of Ang II, compared with the cell-surface expression of receptors in cells that were not exposed to Ang II (vehicle-treated cells).

2.7.

FRET Microscopy and Data Processing

The fluorophore pairs used for FRET imaging in this study were AT1R -EGFP (as donor dipole) and Alexa Fluor 555 (as acceptor dipole) conjugated with Rab4 or Rab11 antibodies (Alexa Fluor 555 protein labeling kit, Molecular Probe). Seven images were acquired for each FRET analysis, as described,23 with an Olympus Fluoview FV300 laser scanning confocal microscope equipped with a 60×1.4 NA objective, Argon (488nm) and HeNe (543nm) laser, and emission filters 51550nm and 590-nm long press (LP) filter. Either single-labeled donor or acceptor or double-labeled samples were acquired under the same conditions throughout the image collection. The uncorrected FRET images (uFRET) were acquired by donor excitation in the acceptor channel, which contained pure FRET (pFRET) and contaminations from both donor and acceptor spectral bleed-through (SBT). pFRET images were generated by employing a described algorithm23 for pixel-by-pixel removal of donor and acceptor SBT on the basis of matched fluorescence levels between the double-labeled specimen and the single-labeled reference specimens.

ROIs were selected in the uFRET images.23 In this study, we used image (e) (donor excitation in the donor channel of the double-labeled specimen) as the reference image for selection of ROIs to determine the plasma membrane, cytoplasm, and perinuclear compartments. Image g was acquired at acceptor excitation in the acceptor channel of the double-labeled specimen.

The percentage of energy transfer efficiency (E%) images was processed on a pixel-by-pixel basis by using the following equation:

E%=1{Ida(Ida+pFRET×(PdPa)×(SdSa)×(QdQa))},
where Pd and Pa are the photo multiplier tube (PMT) gains of donor and acceptor channels; Sd and Sa are the spectral sensitivity of donor and acceptor channels provided by the manufacturer; Qd and Qa are the donor and acceptor quantum yield, measured by spectrofluorometer, as described28; Ida is the image of donor excitation in the donor channel of the double-label samples after removing the background; and pFRET is the “processed FRET” or “pure FRET.” The calculation of distance of donor and acceptor (r) was based on the equation as described in Ref. 23: r=R0[(1E)1]16 ; Förster’s distance R0 in this study was 67.5Å .

2.8.

Statistical Analysis

Results are expressed as mean (M) ± standard error (SE), as indicated. Significant differences among groups were determined by factorial ANOVA and the Student-Newman-Keuls test. P<0.05 was considered statistically significant (SigmaStat 3.0, SPSS, Inc., Chicago).

3.

Results

3.1.

Subcellular Location of Human AT1R , Rab4, and Rab11

In HEK 293 cells under basal conditions, human AT1R tagged with EGFP was observed primarily at the plasma membrane [Fig. 3a ] but also in the intracellular membrane, perinuclear compartments, and cytoplasm [Fig. 3a], consistent with previous observations.22, 27

Fig. 3

Subcellular distribution of the AT1R (a), Rab4 (b), and Rab11 (c) in AT1R HEK 293 cells. The AT1R , tagged with EGFP at its C-terminal, is mainly localized at the plasma membrane. Both Rab4 and Rab11 are scattered throughout the cytoplasm; portions of Rab11 reside in the perinuclear compartments. (d) Overlay of (a) ( AT1R -GFP, green) and (b) (Rab4, red); (e) overlay of (a) and (c) (Rab11, blue); (f) overlay of (a), (b), and (c). Bar, 10μm .

031206_1_052803jbo3.jpg

Endogenous Rab4 staining was observed in typical vesicles scattered throughout the cytoplasm, and very occasionally concentrated in the perinuclear compartments [Fig. 3b]. Endogenous Rab11 was scattered throughout the cytoplasm as well, but most often, Rab11 was observed to concentrate in the perinuclear areas [Fig. 3c]. Overall, Rab4 was more dispersed than Rab11 throughout the cytoplasm, but neither Rab4 nor Rab11 was observed at the plasma membrane. These observations are in agreement with studies using GFP-tagged Rab4 and Rab11.6, 22

Minimal, if any, co-localization was observed between AT1R and Rab4 [Fig. 3d] or Rab11 [Fig. 3e]. Few co-localizations were observed among AT1R , Rab4, and Rab11 [Fig. 3f].

3.2.

Recycling Course of AT1R

In this report, the cell surface AT1R at the basal state was set at 100%. As shown in Fig. 4 , the relative surface intensity of AT1R is 31.8±5.3% ( n=33 cells) when cells were treated with 100nM Ang II for 15min , a time considered as the start of recycling (time 0min ); subsequent recycling of AT1R to the plasma membrane was quantified at the indicated time points after removing of Ang II. The membrane surface AT1R fluorescence intensity was directly related to recovery time (t) : 0.8950.58et23.8 , which followed a first-order exponential curve [Fig. 4a]. After 45min , the cell surface AT1R reached slightly over 75% of its basal level, and close to 90% of its basal level at about 2h , similar to that reported22 for the rat AT1AR , but much slower than that14, 17 for class A GPCRs, e.g., β2AR . However, only 90% AT1R was expressed at the plasma membrane at steady state (Fig. 4), probably due to the lack of newly synthesized AT1R for replacement, implying that 10% of AT1Rs were processed for degradation.

Fig. 4

Recycling of AT1R to the cell surface. AT1R HEK 293 cells were stimulated with Ang II ( 100nM , 15min ) and then were placed on ice. After thorough washing, the cells were incubated in complete culture medium containing 20μg of cycloheximide at 37°C in 5% CO2 for the indicated times. Then, cells were fixed with 4% paraformaldehyde, as described in Sec. 2. The amount of cell surface AT1R was assessed by the average intensity of AT1R fluorescence at the plasma membrane using Metamorph 7.0. Data are mean ± SE; the data were plotted with first-order exponential fit (a), second-order exponential fit (b), and second-order polynomial fit (c), respectively, using OriginLab 6.1.

031206_1_052803jbo4.jpg

For a first-order exponential fit of the data, the following values are obtained: R2 is 0.9931, with two degrees of freedom, and an absolute of square of 0.00168; the values for a second-order exponential fit [Fig. 4b] are: R2 is 0.5833, with one degree of freedom, and an absolute of square is 0.1014. The second-order polynomial curve is a poor fit [Fig. 4c]. These analyses show that AT1R recovery rate best fits a first-order exponential equation, consistent with a single recycling pathway for human AT1R .

In the following studies, for convenience, we divided the entire recycling course into early (from time 0 to 15min ), middle (from 15min to 45min ), and late (over 45min ) recycling stages.

3.3.

Role of Rab4 and Rab11 in the Early Stage of AT1R Recycling

FRET was not observed between AT1R and Rab4 or Rab11 during the basal state (data not shown), which is consistent with the absence of co-localization of AT1R with either Rab4 or Rab11 in the basal state (Fig. 3).

At the start of recycling (time 0), obvious FRET was observed in the cytoplasm between Rab4 and AT1R [Fig. 5a ], the efficiency of energy transfer (E%) was 28.3±9.1% ( n=34 cells), the estimated distance was 78.8Å (Table 1 ), but no FRET was observed between Rab11 and AT1R [Fig. 5b, Table 1]. The association of AT1R and Rab4, but not AT1R and Rab11 was also observed by immunoprecipitation [Fig. 1a, lane 2].

Fig. 5

FRET analysis of AT1R and Rab4 (a) or AT1R and Rab11 (b) at recycling time 0. As described in Sec. 2, regions of interest (ROIs) were drawn in image e, rectangles () indicate the plasma membrane, ovals (O) indicates cytoplasm, and freehand drawings indicate perinuclear compartments. The pFRET and E% images were processed by programs developed at the K. M. Keck Center for Cellular Imaging, University of Virginia (Charlottesville). Bar, 10μm .

031206_1_052803jbo5.jpg

Table 1

Calculation of efficiency of energy transfer (E%) and molecular proximity (R) between AT1R and Rab4 or Rab11 during the entire AT1R recycling course. AT1R HEK 293 cells were treated and fixed as described in Sec. 2. AT1R -EGFP is the donor; the acceptor is Rab4 or Rab11. FRET analysis is described in Figs. 5, 6, 7, 8, 9. Data are mean±SE ; n , number of cells analyzed, Infin, infinity.

Plasma membrane Cytoplasm Perinuclear compartment
Recycling time (min)Acceptor n E (%) R(Å) E (%) R(Å) E (%) R(Å)
0Rab4340infin 28.3±9.1 78.80infin
Rab11340infin0infin0infin
15Rab4350infin 23.4±6.7 82.3 16.3±5.3 88.7
Rab11290infin 11.6±3.3 94.7 14.9±7.8 90.2
45Rab4460infin 21.0±2.1 84.2 34.5±4.1 75.1
Rab11360infin 17.8±2.2 87.1 37.4±6.5 73.6
120Rab4250infin 3.31±1.1 NA0infin
Rab1126 14.6±3.3 89.8 4.60±2.2 NA 13.8±2.1 91.6
180Rab4150infin0infin0infin
Rab11150infin0infin0infin

At time 15min , FRET was obvious between Rab4 and AT1R in cytoplasm and perinuclear compartments, especially in vesicles in the cytoplasm [Fig. 6a ], the E % was 23.4±6.7% ( n=35 cells) and 16.3±5.3% ( n=35 cells), respectively (Table 1). FRET was also observed between Rab11 and AT1R [Fig. 6b] in perinuclear compartments ( 14.9±7.8% , n=29 cells) and cytoplasm ( 11.6±3.3 , n=29 cells). No FRET was observed at the plasma membrane between AT1R with either Rab4 or Rab11 (Fig. 6). The association of Rab4 and Rab11 with AT1R was also observed by immunoprecipitation [Fig. 1a, lane 3]. These observations indicated that Rab4 played a major role(s) during the early recycling period; Rab11 could also play some role in this stage.

Fig. 6

FRET analysis of AT1R and Rab4 (a) or AT1R and Rab11 (b) at recycling time 15min . As described in Sec. 2, ROIs were drawn in image e, rectangles () indicate the plasma membrane, ovals (O) indicate cytoplasm, and freehand drawings indicate perinuclear compartments. The pFRET and E% images were processed by programs developed at the K. M. Keck Center for Cellular Imaging, University of Virginia (Charlottesville). Bar, 10μm .

031206_1_052803jbo6.jpg

3.4.

Role of Rab4 and Rab11 in the Middle Stage of AT1R Recycling

At time 45min , FRET between Rab4 and AT1R in the cytoplasm minimally decreased ( 21.0±2.1% , n=46 cells), but increased in perinuclear compartments ( 34.5±4.1% , n=46 cells) [Fig. 7a ; Table 1], compared to the early recycling stage. In contrast, FRET between Rab11 and AT1R increased in both the cytoplasm ( 17.84±2.2% , n=36 cells) and perinuclear compartments ( 37.4±6.5% , n=36 cells) [Fig. 7b] compared to its early stage (p<0.05) . At 45min , no FRET was observed between AT1R and Rab4 or Rab11 at the plasma membrane [Fig. 7; Table 1). Of note, the calculated E% of Rab4 and AT1R ( 34.5±4.1% , n=46 cells) was similar to that of Rab11 and AT1R ( 37.4±6.5% , n=36 cells) (p> 0.05) ; both Rab4 and Rab11 were co-immunoprecipitated by the GFP antibody (for AT1R ) [Fig. 1a, lane 4] and vice versa (data not shown). Furthermore, gene knockdown of Rab4 by specific Rab4 siRNA disrupted the association of AT1R with Rab11 [Fig. 1c]; Rab11 gene knockdown also disrupted the association of Rab4 with AT1R [Fig. 1d]. All of these data indicated that Rab4 and Rab11 were in the same recycling endosomes for AT1R trafficking at this stage. Therefore, both Rab4 and Rab11 play important roles in AT1R trafficking during this period.

Fig. 7

FRET analysis of AT1R and Rab4 (a) or AT1R and Rab11 (b) at recycling time 45min . As described in Sec. 2, ROIs were drawn in image e, rectangles () indicate the plasma membrane, ovals (O) indicate cytoplasm, and freehand drawings indicate perinuclear compartments. The pFRET and E% images were processed by programs developed at the K. M. Keck Center for Cellular Imaging, University of Virginia (Charlottesville). Bar, 10μm .

031206_1_052803jbo7.jpg

3.5.

Role of Rab4 and Rab11 in the Late Stage of AT1R Recycling

At time 2h , no FRET was observed between Rab4 and AT1R in the cytoplasm, perinuclear compartments, and the plasma membrane [Fig. 8a ], but obvious FRET was still observed between Rab11 and AT1R in the perinuclear compartments [Fig. 8b]. The remarkable observation in this late period is that FRET occurred at the plasma membrane between Rab11 and AT1R ( 14.6±3.3% , n=26 cells) [Fig. 8b; Table 1], indicating the importance of Rab11 in the late stage of AT1R recycling.

Fig. 8

FRET analysis of AT1R and Rab4 (a) or AT1R and Rab11 (b) at recycling time 2h . As described in Sec. 2, ROIs were drawn in image e, rectangles () indicate the plasma membrane, ovals (O) indicate cytoplasm, and freehand drawings indicate perinuclear compartments. The pFRET and E% images were processed by programs developed at the K. M. Keck Center for Cellular Imaging, University of Virginia (Charlottesville). Bar, 10μm .

031206_1_052803jbo8.jpg

At time 3h , no FRET was observed between Rab4 or Rab11 and AT1R at the plasma membrane, cytoplasm, or perinuclear compartments (Fig. 9 ; Table 1), similar to that observed at the basal state (data not shown).

Fig. 9

FRET analysis of AT1R and Rab4 (a) or AT1R and Rab11 (b) at recycling time 3h . As described in Sec. 2, ROIs were drawn in image e, rectangles () indicate the plasma membrane, ovals (O) indicate cytoplasm, and freehand drawings indicate perinuclear compartments. The pFRET and E% images were processed by programs developed at the K. M. Keck Center for Cellular Imaging, University of Virginia (Charlottesville). Bar, 10μm .

031206_1_052803jbo9.jpg

3.6.

Interruption of AT1R Recycling by Rab4, Rab11 Gene Silencing

The AT1R recovery rate was markedly decreased in either Rab4 or Rab11 siRNA- treated cells (Fig. 2), which confirmed the conclusion obtained from the FRET studies that both Rab4 and Rab11 regulate the recycling of AT1R .

3.7.

Relationship of Rab4 and Rab11 During the Entire AT1R Recycling Course

In the basal state [Fig. 10a ] and the start of recycling, time 0 [Fig. 10b] no co-localization was observed between Rab4 and Rab11. At 15min [Fig. 10c] and 45min [Fig. 10d], obvious co-localization of Rab4 and Rab11 was observed, and the greatest co-localization occurred at time 45min , predominantly at perinuclear compartments. At the late stage of the recycling period, co-localization was no longer observed [Figs. 10e and 10f].

Fig. 10

Dynamic relationship between Rab4 and Rab11 during the AT1R recycling course. At the basal state (a) and recycling time 0 (b), no co-localization exists between Rab4 and Rab11; at recycling time 15min (c), a small portion of Rab11 is observed to co-localize with Rab4, and the calculated co-localization of Rab11 over Rab4 is 10.3±1.4% ; at the middle stage of recycling, time 45min (d), obvious co-localization between Rab4 and Rab11 is observed in the perinuclear compartments and the cytoplasm, and the calculated overall co-localization of Rab4 over Rab11 is 34.1±3.3% ; at the late stage of recycling, times 2h (e) and 3h (f), no obvious co-localization is observed between Rab4 and Rab11. Red, Rab4; blue, Rab11; magenta, co-localization between Rab4 and Rab11. Data (mean ± SE) were from 24 to 65 cells per time point. Bar, 10μm .

031206_1_052803jbo10.jpg

4.

Discussion

The quantity of cell surface receptors is important for the cell to maintain its normal functions and responses to environmental changes.1 Receptor expression on the cell surface is maintained by a dynamic balance among internalization, endocytosis, degradation, exocytosis, and recycling. The receptor recycling was initially thought to be a bulk flow process.29 However, subsequent studies have shown that it is a regulated process. For example, the PDZ (PSD-95, Dlg, and ZO-1) motif30 of β2AR and the MRS (MOR-derived endocytic recycling sequence) sequence of μ opioid receptors31 are important for their rapid recycling, respectively. In recent years, it has become widely appreciated that Rab4 and Rab11 are responsible for the regulation of receptor recycling. 5, 6, 7, 8, 9, 10, 11, 32, 33, 34, 35, 36 Transferrin receptor (Tfn) recycles efficiently to the cell surface via two distinct pathways: the rapid pathway is mediated by Rab4, while the slow pathway is initiated by tubular extension from sorting endosomes through Rab11-positive perinulear endosomes.5, 35, 36 It is also accepted that the Rab4-mediated rapid pathway is utilized for class A GPCR recycling, such as β2AR , similar to the rapid pathway of Tfn. The class B GPCRs, including V2 vasopressin receptor,18 m4AchR,21 and somatostatin receptor,37 recycle through the Rab11-mediated slow pathway, similar to the slow recycling of Tfn. AT1R , which belongs to class B GPCR, recycles slowly back to the cell surface after internalization.5, 22

The molecular mechanism for AT1R recycling has been controversial. ARAP1, or type 1 angiotensin II receptor-associated protein 1, has been shown to facilitate the AT1R recycling to the cell surface,38 but this mechanism is not yet fully accepted. Ferguson and co-workers8, 16 proposed a Rab11-mediated AT1R slow recycling model after studying the role of wild-type Rab11 and constitutively active Rab11 (Q70L) in the recycling of the rat AT1R . Hunyady 22 have observed that Rab4 also co-localizes with AT1R and proposed two distinct rat AT1AR recycling models, based on differential sensitivity to wortmannin, a PI3 kinase inhibitor. In the current study, both co-immunoprecipitation of AT1R with Rab4 [Fig. 1a] and FRET was observed between Rab4 and AT1R during the early (Figs. 5 and 6) and middle (Fig. 7) periods of AT1R recycling, consistent with observations22 that Rab4 also plays a role in the recycling of AT1R . However, there may not be two separate Rab pathways for human AT1R recycling: (1) during the entire AT1R recycling period, no FRET between Rab4 and AT1R was observed at the plasma membrane or subplasma membrane. Instead, FRET between AT1R and Rab11 was observed at the plasma membrane or subplasma membrane at the late recycling stage [Fig. 8b]; (2) in the current study, the AT1R recovery rate fits a first-order [Fig. 4a] but not second-order exponential equation [Figs. 4b and 4c], consistent with one sequential recycling pathway.

FRET is revolutionizing studies in life sciences and is widely applied in biology, biochemistry, immunology, cell and molecular biology, and clinical medicine to study protein-protein interaction, cellular signaling, conformational structure, ligand-receptor interaction, and diagnosis of certain diseases.24 It is worthwhile to mention the advantage of pixel-by-pixel analysis in the current protocol, which enables the quantitative detection of FRET occurrence and removal of spectral bleedthrough from both donor and acceptor.23 Pixel-by-pixel analysis also enables the detection of the spatial and temporal protein-protein interaction inside cells. Even though FRET can be measured at 10 to 100Å distance of molecular proximity using the current protocol, the accurate location of a particular compartment is still challenging.

In the current study, FRET was observed and analyzed spatially into three compartments: the plasma membrane, cytoplasm, and perinuclear compartments. At the early stage of recycling, internalized human AT1R were mainly in Rab4-positive compartments in the cytoplasm [Fig. 5a]. No FRET was observed between Rab4 and human AT1R at the plasma membrane [Fig. 6a], indicating no rapid AT1R recycling occurred with Rab4. At the middle stage, FRET of AT1R with Rab4 and Rab11 was observed (Fig. 7), and the association of AT1R with both Rab4 and Rab11 was supported by the co-IP data [Fig. 1a]. The association was disrupted by either Rab4 or Rab11 gene knockdown [Figs. 1c and 1d], indicating that AT1R was localized mainly in compartments containing both Rab4 and Rab11 at this stage. However, at the late stage, AT1R was localized mainly in Rab11-positive endosomes, both in the perinuclear compartments and at the plasma or subplasma membrane areas (Fig. 8). Rab4 or Rab11 gene knockdown decreased the AT1R recovery rate (Fig. 2). Thus, our data indicate that both Rab4 and Rab11 coordinately regulate the entire recycling of AT1R .

Based on the current and previous reports, a single recycling pathway for human AT1R recycling coordinated by both Rab4 and Rab11 is proposed (Fig. 11 ). Internalized AT1R rapidly appears in the CCVs. CCVs then fuse with Rab5/Rab4-positive early endosomes. The exact role(s) of Rab4 is not clear in the early endosomes, but it may enable the cargoed AT1R vesicles to fuse with Rab11-positive perinuclear compartments. After the completion of fusion, Rab11 and Rab4 form common recycling endosomes mainly at the perinuclear compartments. Subsequently, the AT1R destined for recycling buds off, via Rab11, and is recycled back to the plasma membrane by fusing Rab11-positive endosomes with plasma membrane.

Fig. 11

A model of human AT1R recycling regulated by Rab4 and Rab11. Rab4 plays a major role in the early stage of AT1R recycling. During the middle stage, both Rab4 and Rab11 are important in the regulation of AT1R recycling. Rab11 plays a major role in the late stage of AT1R recycling. Arrows denote AT1R transport or fusion between compartments during the recycling period. Due to the space limitation, other important steps such as the initial Rab5 common step9 and the later step of multiple vesicle bodies22 are not shown. PM, plasma membrane.

031206_1_052803jbo11.jpg

Both Rab4 and Rab11 are important in the regulation of human AT1R recycling. Like other small GTPases, Rab4 and Rab11 have active GTP-bound and inactive GDP-bound forms, which are regulated by their GTPase-activating proteins, guanine nucleotide dissociation inhibitor, and guanine nucleotide exchange proteins.39, 40 The identification of the specific regulators could help us to better understand the regulation of AT1R recycling.

Acknowledgments

We are grateful to Dr. Tamas Balla (Endocrinology and Reproduction Research Branch, NICHD, National Institutes of Health, Bethesda, Maryland 20892) for critical reading of the manuscript, Drs. P. M. Lanctôt and G. Guillemette (Université de Sherbrooke, Canada) for the AT1R -GFP construct and its empty vector pEGFP-N1, Dr. Susette Mueller (Lombardi Comprehensive Cancer Center, Georgetown University, Washington, DC) for the assistance with confocal microscopy. This study was supported in part by grants from the National Institutes of Health (Grant Nos. HL074940-01, HL23081, DK39308, HL68686, and DK52612), the K. M. Keck Foundation at the University of Virginia (Charlottesville), and U.S. Public Health Service Grant Nos. 2P30-CA-51008 and 1S10RR15768-01.

References

1. 

P. A. Jose, G. M. Eisner, and R. A. Felder, “The renal dopamine receptors in health and hypertension,” Pharmacol. Ther., 80 149 –182 (1998). 0163-7258 Google Scholar

2. 

M. de Gasparo, K. J. Catt, T. Inagami, J. W. Wright, and T. Unger, “International union of pharmacology XXIII. The angiotensin II receptors,” Pharmacol. Rev., 52 415 –472 (2000). 0031-6997 Google Scholar

3. 

S. S. G. Ferguson, “Evolving concepts in G protein-coupled receptor endocytosis: the role in receptor desensitization and signaling,” Pharmacol. Rev., 53 1 –24 (2001). 0031-6997 Google Scholar

4. 

R. H. Oakley, S. A. Laporte, J. A. Holt, M. G. Caron, and L. S. Barak, “Differential affinities of visual arrestin, β-arrestin 1, and β-arrestin 2 for G protein-coupled receptors delineate two major classes of receptors,” J. Biol. Chem., 275 17201 –17210 (2000). 0021-9258 Google Scholar

5. 

Z. Gáborik and L. Hunyady, “Intracellular trafficking of hormone receptors,” Trends Endocrinol. Metab., 15 286 –293 (2004). Google Scholar

6. 

M. Zerial and H. McBride, “Rab proteins as membrane organizers,” Nat. Rev. Mol. Cell Biol., 2 107 –117 (2001). 1471-0072 Google Scholar

7. 

J. B. Pereira-Leal and M. C. Seabra, “Evolution of the Rab family of small GTP-binding proteins,” J. Mol. Biol., 313 889 –901 (2001). 0022-2836 Google Scholar

8. 

J. L. Seachrist and S. S. Ferguson, “Regulation of G protein-coupled receptor endocytosis and trafficking by Rab GTPases,” Life Sci., 74 225 –235 (2003). 0024-3205 Google Scholar

9. 

S. Pfeffer, “Membrane domains in the secretory and endocytic pathways,” Cell, 112 507 –517 (2003). 0092-8674 Google Scholar

10. 

P. van der Sluijs, M. Hull, A. Zahraoui, A. Tavitian, B. Goud, and I. Mellman, “The small GTP-binding protein rab4 is associated with early endosomes,” Proc. Natl. Acad. Sci. U.S.A., 88 6313 –6317 (1991). 0027-8424 Google Scholar

11. 

S. de Renzis, B. Sonnichsen, and M. Zerial, “Divalent Rab effectors regulate the subcompartmental organization and sorting of early endosomes,” Nat. Cell Biol., 4 124 –133 (2002). 1465-7392 Google Scholar

12. 

O. Ullrich, S. Reinsch, S. Urbe, M. Zerial, and R. G. Parton, “Rab11 regulates recycling through the pericentriolar recycling endosome,” J. Cell Biol., 135 913 –924 (1996). 0021-9525 Google Scholar

13. 

W. Chen, Y. Feng, D. Chen, and A. Wandinger-Ness, “Rab11 is required for trans-Golgi network-to-plasma membrane transport and a preferential target for GDP dissociation inhibitor,” Mol. Biol. Cell, 9 3241 –3257 (1998). 1059-1524 Google Scholar

14. 

J. L. Seachrist, P. H. Anborgh, and S. S. G. Ferguson, “β2-adrenergic receptor internalization, endosomal sorting, and plasma membrane recycling are regulated by rab GTPases,” J. Biol. Chem., 275 27221 –27228 (2000). 0021-9258 Google Scholar

15. 

R. H. Moore, E. E. Millman, E. Alpizar-Foster, W. Dai, and B. J. Knoll, “Rab11 regulates the recycling and lysosome targeting of β2-adrenergic receptors,” J. Cell. Sci., 117 3107 –3117 (2004). 0021-9533 Google Scholar

16. 

L. B. Dale, J. L. Seachrist, A. V. Babwah, and S. G. Ferguson, “Regulation of angiotensin II type 1A receptor intracellular retention, degradation, andrecycling by Rab5, Rab7, and Rab11 GTPases,” J. Biol. Chem., 279 13110 –13118 (2004). 0021-9258 Google Scholar

17. 

P. H. Anborgh, J. L. Seachrist, L. B. Dale, and S. S. G. Ferguson, “Receptor/β-arrestin complex formation and the differential trafficking and resensitization of β2-adrenergic and angiotensin II type1A receptors,” Mol. Endocrinol., 14 2040 –2053 (2000). 0888-8809 Google Scholar

18. 

G. Innamorati, C. Le Gouill, M. Balamotis, and M. Birnbaumer, “The long and the short cycle. Alternative intracellular routes for trafficking of G-protein-coupled receptors,” J. Biol. Chem., 276 13096 –13103 (2001). 0021-9258 Google Scholar

19. 

G. H. Fan, L. A. Lapierre, J. R. Goldenring, and A. Richmond, “Differential regulation of CXCR2 trafficking by Rab GTPases,” Blood, 101 2115 –2124 (2003). 0006-4971 Google Scholar

20. 

E. Hamelin, C. Thériault, G. Laroche, and J. L. Parent, “The intracellular trafficking of the G protein-coupled receptor TP β depends on a direct interaction with Rab11,” J. Biol. Chem., 280 36195 –36205 (2005). 0021-9258 Google Scholar

21. 

L. A. Volpicelli, J. J. Lah, G. Fang, J. R. Goldenring, and A. I. Levey, “Rab11a and myosin Vb regulate recycling of the M4 muscarinic acetylcholine receptor,” J. Neurosci., 22 9776 –9784 (2002). 0270-6474 Google Scholar

22. 

L. Hunyady, A. J. Baukal, Z. Gaborik, J. A. Olivares-Reyes, M. Bor, M. Szaszak, R. Lodge, K. J. Catt, and T. Balla, “Differential PI 3-kinase dependence ofearly and late phases of recycling of the internalized AT1 angiotensin receptor,” J. Cell Biol., 157 1211 –1222 (2002). 0021-9525 Google Scholar

23. 

Y. Chen, M. Elangovan, and A. Periasamy, “FRET data analysis: the algorithm,” Molecular Imaging: FRET Microscopy and Spectroscopy, 126 –145 Oxford University Press, NewYork (2005). Google Scholar

24. 

A. Periasamy, “Fluorescence resonance energy transfer microscopy: a mini review,” J. Biomed. Opt., 6 287 –291 (2001). https://doi.org/10.1117/1.1383063 1083-3668 Google Scholar

25. 

J. S. Rodman and A. Wandinger-Ness, “Rab GTPases coordinate endocytosis,” J. Cell. Sci., 113 183 –192 (2000). 0021-9533 Google Scholar

26. 

P. M. Lanctôt, P. C. Leclerc, E. Escher, R. Leduc, and G. Guillemette, “Role of N-glycosylation in the expression and functional properties of human AT1 receptor,” Biochemistry, 38 8621 –8627 (1999). 0006-2960 Google Scholar

27. 

H. Li, I. Armando, P. Yu, C. Escano, S. Mueller, L. Asico, A. Pascua, Q. Lu, X. Wang, V. A. M. Villar, J. E. Jones, Z. Wang, A. Periasamy, Y. S. Lau, P. Soares-da-Silva, K. Creswell, G. Guillemette, D. R. Sibley, G. Eisner, R. A. Felder, and P. A. Jose, “Dopamine 5 receptor mediates Ang II type 1 receptor degradation via a ubiquitin-proteasome pathway in mice and human cells,” J. Clin. Invest., 118 2180 –2189 (2008). 0021-9738 Google Scholar

28. 

J. R. Lakowicz, G. Piszczek, and J. S. Kang, “On the possibility of long-wavelength long-life time high-quantum-yield luminophores,” Anal. Biochem., 288 62 –75 (2001). 0003-2697 Google Scholar

29. 

G. Apodaca, L. A. Katz, and K. E. Mostov, “Receptor-mediated transcytosis of IgA in MDCK cells is via apical recycling endosomes,” J. Cell Biol., 125 67 –86 (1994). 0021-9525 Google Scholar

30. 

Y. Xiang and B. Kobilka, “The PDZ-binding motif of the β2-adrenoceptor is essential for physiologic signaling and trafficking in cardiac myocytes,” Proc. Natl. Acad. Sci. U.S.A., 100 10776 –10781 (2003). https://doi.org/10.1073/pnas.1831718100 0027-8424 Google Scholar

31. 

M. Tanowitz and M. von Zastrow, “A novel endocytic recycling signal that distinguishes the membrane trafficking of naturally occurring opioid receptors,” J. Biol. Chem., 278 45978 –45986 (2003). 0021-9258 Google Scholar

32. 

F. R. Maxfield and T. E. McGraw, “Endocytic recycling,” Nat. Rev. Mol. Cell Biol., 5 121 –132 (2004). 1471-0072 Google Scholar

33. 

E. S. Ward, C. Martinez, C. Vaccaro, J. Zhou, Q. Tang, and R. J. Ober, “From sorting endosomes to exocytosis: association of Rab4 and Rab11 GTPases with the Fc receptor, FcRn, during recycling,” Mol. Biol. Cell, 16 2028 –2038 (2005). 1059-1524 Google Scholar

34. 

D. Sheff, L. Pelletier, C. B. O’Connell, G. Warren, and I. Mellman, “Transferrin receptor recycling in the absence of perinuclear recycling endosomes,” J. Cell Biol., 156 797 –804 (2002). 0021-9525 Google Scholar

35. 

J. Gruenberg, “The endocytic pathway: a mosaic of domains,” Nat. Rev. Mol. Cell Biol., 2 721 –730 (2001). 1471-0072 Google Scholar

36. 

J. L. Rosenfeld, B. J. Knoll, and R. H. Moore, “Regulation of G-protein-coupled receptor activity by rab GTPases,” Recept. Channels, 8 87 –97 (2002). 1060-6823 Google Scholar

37. 

D. Roosterman, O. J. Kreuzer, N. Brune, G. S. Cottrell, N. W. Bunnett, W. Meyerhof, and M. Steinhoff, “Agonist-induced endocytosis of rat somatostatin receptor 1,” Endocrinology, 148 1050 –1058 (2007). 0013-7227 Google Scholar

38. 

D. F. Guo, I. Chenier, V. Tardif, S. N. Orlov, and T. Inagami, “Type 1 angiotensin II receptor-associated protein ARAP1 binds and recycles the receptor to the plasma membrane,” Biochem. Biophys. Res. Commun., 310 1254 –1265 (2003). 0006-291X Google Scholar

39. 

M. C. Seabra and C. Wasmeier, “Controlling the location and activation of Rab GTPases,” Curr. Opin. Cell Biol., 16 451 –457 (2004). 0955-0674 Google Scholar

40. 

R. S. Goody, A. Rak, and K. Alexandrov, “The structural and mechanistic basis for recycling of Rab proteins between membrane compartments,” Cell. Mol. Life Sci., 62 1657 –1670 (2005). 1420-682X Google Scholar
© (2008) Society of Photo-Optical Instrumentation Engineers (SPIE)
Hewang Li, Hui-Fang Li, Robin A. Felder, Ammasi Periasamy, and Pedro A. Jose "Rab4 and Rab11 coordinately regulate the recycling of angiotensin II type I receptor as demonstrated by fluorescence resonance energy transfer microscopy," Journal of Biomedical Optics 13(3), 031206 (1 May 2008). https://doi.org/10.1117/1.2943286
Published: 1 May 2008
JOURNAL ARTICLE
10 PAGES


SHARE
Advertisement
Advertisement
Back to Top