2.1.

Plasmid and Yeast Strain Constructions

The pYES2-97Q-eGFP plasmid was based on the pYES2-103Q-eGFP, kindly provided by Sherman, was described in Ref. 40. A reduction of six glutamine residues in the expected repeat region was found on conducting the DNA sequencing of the plasmid, hence the new construct pYES2-97Q-eGFP, used throughout all the subsequent experiments. The pYES2-eGFP plasmid construct was derived from pYES2-97Q-eGFP by deleting the DNA region encoding 97Q. With polymerase chain reaction (PCR), the DNA fragment covering Gal1 promoter and Flag tag of pYES2-97Q-eGFP was amplified using EcoRI-Gal-97Q-ADE2 $5^{\prime }$ primer: GGAATTCCGCTTAATGGGGCGCTACAG and Gal-Flag-SmaI $3^{\prime }$ primer: TGCCTCCCGGGTTTGAGGGACTCGAAGGCCTTC. The PCR product was digested with Kpn I and Sma I, and then replaced the Kpn I-Sma I fragment of pYES-97Q-eGFP to create pYES2-eGFP. Each of the two plasmids (pYES2-97Q-eGFP and pYES2-eGFP) was transformed into Saccharomyces cerevisiae W303-1a (MATa ade2-1 trp1-1 ura3-1 leu2-3,112 his3-11,15 can1-100).

To make the hsp104 knock-out strain $\left(\mathrm{hsp}104\Delta \right)$ , the entire coding sequence of HSP104 gene was replaced with a KanMX gene by the one-step gene disruption method.⁴¹ The targeting DNA was amplified by PCR (HSP104-KAN $5^{\prime }$ primer: ATGAACGACCAAACGCAATTTACAGAAAGGGCTCTAACGATTTTGACGTTAGCTTGCCTCGTCCCCGCCGG and HSP104-KAN $3^{\prime }$ primer: TTAATCTAGGTCATCATCAATTTCCATACTGTCCTCATTATCGTCATCACTCGACACTGGATGGCGGCGTTAG, plasmid pUG6 as a template) and transformed into S. cerevisiae W303-1a. Transformants were selected on YPDA/G418 plates and the $\mathrm{hsp}104\Delta$ strain was confirmed by genomic PCR.

2.2.

Development of Ade2-Proficient Strains

Both wild type W303-1a (wt) and $\mathrm{hsp}104\Delta$ cells had characteristic adenine synthesis blockade caused by Ade2 deficiency, which led to the accumulation of intermediates, absorbing in the range of eGFP’s fluorescence. To check the nonradiative transfer from eGFP, the adenine metabolism was restored by turning the cells into Ade2-proficient by introducing the pRS424-Flag-ADE2 plasmid construct.

For this purpose, the ADE2 gene was amplified using BamHI-Flag-ADE2 $5^{\prime }$ primer: CGGGATCCATGGACTACAAGGACGACGATGACAAGCTGGCGACCCTGGAAAAGCTGGATTCTAGAACAGTTGGTATA and NheI-ADE2-HA $3^{\prime }$ primer: CTAGCTAGCTTAGATGATGGCGTAGTCGGGCACGTCGTAGGGGTAATGGCGGCCGCCCTTGTTTTCTAGATAAGCTTC in a PCR reaction. Following BamH I and Nhe I digestion, the resulting fragment was ligated into the pYES2 plasmid, which was linearized by BamH I and Xba I to create pYES2-Flag-ADE2. Using this plasmid as a template, the Flag-tagged ADE2 gene as well as the upstream GAL1 promoter was subsequently subcloned into pRS424 plasmid vector to generate pRS424-Flag-ADE2.

2.3.

Cell Growth Assay

For the assessment of 97Q cytotoxicity, a cell growth assay was carried out. Cells were precultured in synthetic dropout media containing 2% dextrose at $30°\mathrm{C}$ . An appropriate amount of the cell suspension was then transferred to a fresh medium that contained 2% galactose as the sole carbon source to induce the expression of eGFP or 97Q-eGFP. After $12\mathrm{h}$ culturing, the cell density usually reached $\mathrm{O}{\mathrm{D}}_{600}=2$ and the cells were mounted on an agarose slide to measure the cellular distribution of eGFP and its fluorescence lifetime. The influence of Ade2 deficiency was eliminated by reintroducing the expression of the ADE2 gene from pRS424-Flag-ADE2 in these cells.

2.4.

Imaging System Setup

The measurements were conducted on the time-resolved two-photon fluorescence spectroscopy system, built around the modified laser-scanning microscope (IX71, Olympus Corp.). The sample was excited at $860\mathrm{nm}$ by a mode-locked femtosecond linearly polarized Ti:sapphire Mira F-900 laser (Coherent, Inc.), operated in two-photon mode at a $76\text{-}\mathrm{MHz}$ frequency. The wavelength choice is explained with the lowest autofluorescence level detected at this excitation band. The intensity of the laser power was kept within $3.5\mathrm{mW}$ above the objective. The beam was fed into the scanning unit (FV300, Olympus Corp.) and scanned across the sample at the speed controlled externally by a function generator (AFG310, Tektronix Inc.). The $60\times 1.4$ numerical aperture (NA) PlanApochromat lens (Olympus Corp.) focused the beam at the cell samples and collected the fluorescence photons, which were delivered in a nondescanned mode to the photomultiplier tube (H7422-P40, Hamamatsu Photonics K.K.) mounted at the backport of the microscope. A $520\pm 17.5\text{-}\mathrm{nm}$ filter ( $\mathrm{FF}01\text{-}520∕35\text{-}25$ , Semrock) was installed along with the IR cut-off filter (Edmund Optics, Inc.) in the detection channel for the selective acquisition of eGFP fluorescence. Signal synchronization and building of the time-resolved data matrix were conducted by the SPC-830 time-correlated single photon counting (TCSPC) board⁴² (Becker&Hickl GmbH). All the images were taken at $256\times 256\text{pixels}$ resolution with the acquisition time varying in the range of $200\text{to}600\mathrm{s}$ . No significant change of the photon count rate was detected during the measurements.

For the anisotropy imaging, the horizontal polarization of the laser was utilized without additional polarizers in the excitation pathway. A Glan-laser polarizer (GL10, Thorlabs Ltd.) with a coating wavelength range of $300\text{to}600\mathrm{nm}$ was installed in the detection pathway. The measurements in the polarization plane parallel $\left(I_{\parallel }\right)$ and perpendicular $\left(I_{\perp }\right)$ to that of the laser was taken successively by manually rotating the mounted polarizer. To decrease the depolarization caused by the optics, an objective of lower NA (0.9, $40\times$ ) was used for anisotropy imaging. Photon distribution was registered with the TCSPC board with the same settings as for the fluorescence lifetime imaging.

2.5.

Data Analysis

Data analysis via model function fitting, instrument response function (IRF) deconvolution, and color coding were conducted with the commercially available SPCImage software package (v. 2.9, Becker&Hickl, GmbH). A mathematical model was fitted to the experimental data by iterative non-least-squares reconvolution:

The quality of fitting was judged by the residual function distribution and reduced goodness-of-fit parameter calculated by the equation

To remove the background and signal from dead cells with high autofluorescence levels either the regions of interest were marked so that only the pixels inside the region were used to generate the lifetime distribution histogram, or a threshold parameter was used. A pixel binning factor of 2 was applied in our analysis, so that a signal from 25 adjacent pixels was used to derive a single decay curve for further fitting. All the pixels within the specified region and with the number of the photon counts higher than the threshold defined were then analyzed and pixel frequency-weighted lifetime distribution histograms were built.

Fluorescence anisotropy data were analyzed by the custom developed program for MATLAB software package (The Mathworks, Inc.). The program parsed the TCSPC-generated files of the $I_{\parallel }$ and perpendicular $I_{\perp }$ measurements, fetched the photons distribution data and summed together the number of the photons for all 256 time channels in each pixel. The numbers thus obtained were then used for the calculation of steady state anisotropy:

Statistical processing of the data was carried out with the single-factor analysis of variance (ANOVA). The similarity and diversity of the data sets were conducted by comparing the peak values of the fluorescence lifetime histograms recorded from the images.

2.6.

Colocalization Imaging

The wt and $\mathrm{hsp}104\Delta$ cells with the expressed 97Q-eGFP were grown in an adenine-restricted medium (adenine final concentration of $4\mathrm{mg}∕\mathrm{L}$ ) for $24\mathrm{h}$ , resulting in red ade2 dye overproduced and accumulated in vacuole.⁴³ The cells were mounted on the agarose pad of a single-cavity slide and visualized by the fluorescence microscope Axioskop 2 (Carl Zeiss Microimaging Inc.) with a $100\times$ oil immersion objective. The differential interference contrast (DIC) images were taken for phase contrast. eGFP was excited at $470\text{to}500\mathrm{nm}$ , and ade2 dye was excited at $525\text{to}550\mathrm{nm}$ .

3.1.

eGFP Fluorescence Lifetime Decreases in 97Q Aggregates

To study the dynamics of the eGFP fluorescence lifetime in aggregates, the fluorophore was lagated with 97Q protein with a linker of seven aminoacids. The fluorescence decays recorded for eGFP, both expressed solely and fused to 97Q protein, were well fitted with a single-exponential model, as judged by the distribution of residual functions and goodness of fit (Fig. 1 ). Although for the 97Q-eGFP expressed in wt cells, further denoted as 97Q-eGFP(wt), the goodness of fit appeared slightly increased as compared to the free eGFP in same cells [eGFP(wt)], application of a double-exponential decay model did not improve the fitting quality. The difference between the decays was well distinguishable with the one measured from the 97Q-eGFP(wt) having steeper slope.

Fig. 1

Representative fluorescence lifetime decays and histograms of the goodness of fit measured from the eGFP(wt) (black) and 97Q-eGFP(wt) (red). The decay data (a) clearly demonstrates different lifetimes for both samples. The IRF is represented in blue. Both decays could be successfully fitted with single-exponential model, as seen from the residual functions (b) and distribution of the goodness-of-fit histogram obtained from the whole image (c). (Color online only.)

The change in the eGFP lifetime behavior at fusion to the 97Q is well illustrated with the distribution of the averaged histograms, collected from the series of images [Fig. 2 ]. The histogram of eGFP(wt) stretches from $\sim 2\text{to}\sim 2.4\mathrm{ns}$ with the peak value mean of $2.29\pm 0.03\mathrm{ns}$ . Ligation of eGFP to 97Q resulted in the shift of the histogram to the shorter values region. It appears slightly wider with the stretch from $\sim 1.7\text{to}\sim 2.4\mathrm{ns}$ and the maximum mean of $2\pm 0.06\mathrm{ns}$ . The two histograms obtained are well separated and the peak value data set distribution is significantly different $(P<e-22)$ .

Fig. 2

Averaged fluorescence lifetime histograms, measured from the eGFP alone and fused with 97Q. (a) The histogram obtained from the 97Q-eGFP(wt) (dashed line) is significantly shifted to the shorter values range as compared to the eGFP(wt) (solid line). Prevention of aggregation through the expression of 97Q-eGFP in hsp $104\Delta$ cells resulted in the histogram shift back toward the native eGFP values (dotted line). (b) The same dynamics for the 97Q-eGFP lifetime is observed for the Ade2-proficient cells: shortening for 97Q-eGFP(wt Ade2) (dashed line) and restoration of the eGFP-original lifetime for 97Q-eGFP(hsp $104\Delta$ Ade2) (dotted line).

The eGFP(wt) and 97Q-eGFP(wt) also exhibited different distribution patterns in yeast cells (Fig. 3 ). Free eGFP had a diffused distribution with the exception of the vacuole, where little to no signal was detected [Fig. 3]. In contrast to that, the 97Q-eGFP exhibited grain- and cloudlike patterns, indicative of polyQ tract aggregation [Fig. 3]. With the given color coding it is evident that the aggregates exhibit shorter lifetime than the surrounding.

Fig. 3

Color-coded images of fluorescence lifetime distribution of (a) eGFP(wt), (b) 97Q-eGFP(wt), (c) 97Q-eGFP(hsp $104\Delta )$ , (d) 97Q-eGFP(wt Ade2), and (e) 97Q-eGFP(hsp $104\Delta$ Ade2). (Color online only.)

To reveal the role of the aggregation in the lifetime dynamics observed, the 97Q-eGFP was expressed in the $\mathrm{hsp}104\Delta$ strain, where the 97Q aggregation was prevented [hereinafter referred to as $97\mathrm{Q}\text{-}\mathrm{eGFP}\left(\mathrm{hsp}104\Delta \right)$ ]. Intracellular protein aggregation is a complex process involving microtubule-mediated protein transport to the centrosome with further formation of the aggresomes, and regulated by chaperones and ubiquitin-proteasome degradation pathway components.^{44, 45, 46, 47} Among major factors involved in this process are heat shock proteins, which restore native conformation and support proper interaction of proteins aggregated at high temperature or as a result of environmental stress. In particular, overexpression of heat shock proteins Hsp70 and Hsp40 inhibits the formation of large detergent-soluble inclusion bodies, leading to the conversion of the aggregates into soluble forms.⁴⁸ However, for Hsp104, an opposite effect was demonstrated: under a normal growth condition, this protein can assist the formation of nonpathological aggregates, prions, and is essential for polyQ protein aggregation in yeast cells. In the absence of this chaperone, aggregation of prions and polyQ is prevented and these proteins become soluble.^{8, 40, 49, 50}

At aggregation prevention, the averaged lifetime histogram appeared narrower than that for the 97Q-eGFP(wt), and shifted back toward the lifetime values of eGFP(wt) with the peak mean of $2.23\pm 0.03$ [Fig. 2]. Similar to free eGFP, the $97\mathrm{Q}\text{-}\mathrm{eGFP}\left(\mathrm{hsp}104\Delta \right)$ appeared evenly distributed in the cytoplasm of cells [Fig. 3], indicative of the lack of aggregation.

3.2.

Red Metabolites: Influence of Hetero-FRET and pH

The ade2 mutation, characteristic for the W303-1a strain, used in the experiments, is known to block adenine synthesis in cells and lead to the accumulation of intermediate metabolite 4-aminoimidazole ribotide. This colorless compound is synthesized in cytosol with further concentration of its derivatives in the vacuole, where it undergoes polymerization and oxidation, producing a red color.⁵¹ The aminoimidazole and its derivatives were demonstrated in previous works to absorb at the wavelengths range of $\sim 490\text{to}540\mathrm{nm}$ . Therefore, there was a possibility of direct nonradiative energy transfer from eGFP, given the overlapping of its emission and absorption spectra of these metabolites.⁵² This may have caused the decrease of the eGFP lifetime as a donor.²⁹

To examine the possibility of this energy transfer, we conducted control measurements with restored adenine metabolism by expressing Ade2 protein in W303-1a cells. The fluorescence lifetime of 97Q-eGFP in Ade2-proficient cells, hereinafter denoted as 97Q-eGFP(Ade2), exhibited peak value of $2.07\pm 0.02\mathrm{ns}$ , which appeared statistically identical to that of 97Q-eGFP(wt) with $P=0.02$ [Fig. 2, Table 3 in Sec. 4]. Similar to that, the fluorescence lifetime value of $2.24\pm 0.02\mathrm{ns}$ obtained for the 97Q-eGFP in Ade2-proficient $\mathrm{hsp}104\Delta$ cells $\left[97\mathrm{Q}\text{-}\mathrm{eGFP}\left(\mathrm{hsp}104\Delta \mathrm{Ade}2\right)\right]$ was indistinguishable from the results recorded form $97\mathrm{Q}\text{-}\mathrm{eGFP}\left(\mathrm{hsp}104\Delta \right)$ $(P=0.97)$ . The similarity applies also to the spatial distribution of the 97Q-eGFP in Ade2-proficent cells: grains with shorter fluorescence lifetime in wt cells [Fig. 3], and evenly distributed pattern of longer lifetime for 97Q-eGFP in the absence of the Hsp104 chaperone [Fig. 3].

Table 3

Distribution of the P values calculated by a single-tailed ANOVA test.

The red ade2 pigment was also utilized in this study to investigate the influence of low pH on the eGFP lifetime values. Misfolded and aggregated proteins can hamper cellular function, and these proteins normally are degraded by lysosomes or proteasomes.⁵³ In yeast cells, the degradation occurs in vacuoles—organelles with acidic lumen,⁵⁴ which may shorten the eGFP lifetime. To investigate the contribution of pH level to the fluorescence lifetime dynamics observed, we checked the presence of eGFP in vacuole by colocalization experiments. The cells were grown in adenine restriction medium to mark the vacuole with the ade2 red pigment. The results, presented on Fig. 4 , clearly show no overlapping of the eGFP signal with the red color of ade2, originating from the vacuole.

Fig. 4

Fluorescence intensity and differential contrast images of cells (wt and hsp $104\Delta$ ) expressing 97Q-eGFP. The vacuole was marked with the red fluorescent adenine metabolite, ade2 dye. The images clearly show lack of the green eGFP signal from the vacuole. (Color online only.)

3.3.

Homo-FRET in Aggregates

The resonance energy transfer can occur also between the molecules of the same fluorophore given that there is overlap between emission and absorption of the fluorescent species. Unlike FRET between different molecules, energy transfer between like molecules (homo-FRET) is typically not manifested in changes of fluorescence lifetime or intensity.²³ Recent works, however, have demonstrated that in some cases aggregation of fluorophores can still affect the rate of excited state levels depletion hence contributing to its fluorescence lifetime shortening.^{55, 56}

Homo-FRET is usually observed with fluorescence anisotropy imaging microscopy.^{57, 58, 59} On excitation, a pool of molecules with the dipoles oriented collinearly to the excitation light’s electric vector will be preferentially excited, so that in the case of slow rotation, a relatively high anisotropy is expected. As the energy is transferred in a nonradiative manner from the initially excited molecules to other molecules, situated at different angles (except for $90\mathrm{deg}$ ), the photons emitted will then be characterized with decreased anisotropy values.

Depicted on Fig. 5 is a comparison column chart showing the average intensity-weighted steady state anisotropy values measured from eGFP(wt), 97Q- $\mathrm{eGFP}\left(\mathrm{hsp}104\Delta \right)$ , and 97Q-eGFP(wt). The value of $0.49\pm 0.03$ obtained from the eGFP(wt) appeared to be not much lower than the maximal value of 0.57, available at two-photon excitation. This can be explained with a relatively long rotational correlation time for eGFP, so that it slightly affects its depolarization within the radiative decay time.⁶⁰ A strong depolarization was observed for the 97Q-eGFP(wt): an anisotropy value as low as $0.25\pm 0.02$ was recorded. As the volume and molecular mass of the aggregates are much higher than that for the free fluorophore, the rotational depolarization can be ruled out, leading us to the conclusion that homo-FRET is the main cause for the phenomenon observed. A depolarization of eGFP fluorescence as a result of homo-FRET has been also demonstrated in earlier works.⁶¹

Fig. 5

Steady state anisotropy values for the controls [eGFP(wt) and 97Q-eGFP(hsp $104\Delta$ )] and 97Q-eGFP aggregates in wt cells. High values of the steady state anisotropy for the control samples is a result of a slow rotation of the eGFP and nonaggregated fusion protein 97Q-eGFP. The lowest anisotropy value for the aggregated 97Q-eGFP in wt cells is caused by the FRET depolarization. Same phenomenon also causes somewhat lower values of the 97Q-eGFP(hsp $104\Delta$ ) and a larger standard deviation, since the prevention of aggregation in these samples has limited efficiency, which leads to low anisotropy values in some of the measurements.

Contrary to expectations, 97Q- $\mathrm{eGFP}\left(\mathrm{hsp}104\Delta \right)$ exhibited a steady state anisotropy value of $0.44\pm 0.11$ , which was lower than the value observed for the eGFP(wt). This can be partly explained with some probability of aggregation even in the absence of the hsp104. Earlier works have demonstrated that in 10 to 40% of the $\mathrm{hsp}104\Delta$ cells, the aggregates can still be found even in the absence of the chaperone.¹² Indeed, in some measurements, a strong depolarization was observed, with the anisotropy values similar to that of the aggregates.

3.4.

Cytotoxicity and Autofluorescence

The data on the cytotoxicity of the polyQ aggregates in yeast is controversial. In the early studies, none or little toxicity was reported even for 103Q tracts—at most, there was just a slight reduction in final culture density.⁸ Later studies, however, reported toxicity of expanded polyQ especially at the late stages after expression with the accumulation of the aggregated protein in the nucleus, leading to cell death with the markers, characteristic for apoptosis^{62, 63, 64} [mitochondrial fragmentation, reactive oxygen species (ROS) accumulation, and caspases activation). The latter, in its turn, may result in the increased level of autofluorescence intensity and perturbations in the intracellular environment, and hence affect the eGFP fluorescence lifetime.^{65, 66}

To investigate the level of 97Q cytotoxicity in our experiment, cell proliferation of wt and $\mathrm{hsp}104\Delta$ yeast cells was assessed during $12\mathrm{h}$ after the induction of 97Q by measuring the culture’s optical density at $600\mathrm{nm}$ $\left(\mathrm{O}{\mathrm{D}}_{600}\right)$ . The results are presented in Table 1 and Fig. 6 . The $\mathrm{O}{\mathrm{D}}_{600}$ values for all the samples were identical within the first $8\mathrm{h}$ of observation. At the 12th hour, wt cells expressing 97Q exhibited decreased $\mathrm{O}{\mathrm{D}}_{600}$ values as compared to the control cells $(2.38\pm 0.13$ versus $3.14\pm 0.22$ ). For the same time point, a decrease was also observed for the $\mathrm{hsp}104\Delta$ cells: expression of the 97Q resulted in the reduction of the $\mathrm{O}{\mathrm{D}}_{600}$ values from $2.98\pm 0.25$ to $2.57\pm 0.11$ .

Fig. 6

Time-lapse measurement of cell growth after the induction of 97Q-eGFP. Cells harboring empty vector pYES2 did not express 97Q-eGFP and served as controls. No difference was observed for up to the 8th hour. In the 12th hour, a decrease in optical density was detected for both wt and hsp $104\Delta$ cells expressing the 97Q (solid line with circle and dashed line with circles correspondingly) as compared to the control wt (solid line with squares) and hsp $104\Delta$ cells (dashed line with squares).

Table 1

Results of the proliferation assay for wt and hsp 104Δ cells with and without 97Q expression.

The influence of the autofluorescence was checked on the wt and $\mathrm{hsp}104\Delta$ cells with and without expression of the 97Q protein. For all samples, we obtained the value of mean fluorescence lifetime $\left({\tau }_{\mathrm{m}}\right)$ $\sim 1.35\mathrm{ns}$ with the intensity less than 10% of that recorded from the samples with eGFP. As shown in Fig. 7 , on the induction of 97Q the autofluorescence intensity increased. However, the increase was observed both for the wt and $\mathrm{hsp}104\Delta$ cells. Moreover, the autofluorescence, recorded from the $\mathrm{hsp}104\Delta$ cells expressing 97Q appeared somewhat higher than for the wt cells. Therefore, the autofluorescence perturbations could not account for the lifetime dynamics observed.

Fig. 7

Autofluorescence intensity of the samples: (a) wt cells, (b) hsp $104\Delta$ cells, (c) wt cells expressing 97Q, and (d) hsp $104\Delta$ expressing 97Q. The color bar is given in photons numbers. (Color online only.)